|   | union | 
union reads in several sequences, concatenates them and writes them out as a single sequence. The input is typically a list file containing references to multiple sequences or subsequences (regions of a sequence). Optionally, feature information will be used.
The file 'cds.list' contains a list of the regions making up the coding sequence of 'embl:x65923':
| % union Concatenate multiple sequences into a single sequence Input (gapped) sequence(s): @cds.list output sequence [x65921.fasta]: | 
Go to the input files for this example
Go to the output files for this example
| 
   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     (Gapped) sequence(s) filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqout     [ | 
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) | (Gapped) sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required | 
| [-outseq] (Parameter 2) | Sequence filename and optional format (output USA) | Writeable sequence | <*>.format | 
| Additional (Optional) qualifiers | Allowed values | Default | |
| -overlapfile | Sequence overlaps output file (optional) | Output file | <*>.union | 
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| -feature | Use feature information | Boolean value Yes/No | No | 
| -source | Create source features | Boolean value Yes/No | No | 
| -findoverlap | Look for overlaps when joining | Boolean value Yes/No | No | 
| tembl-id:X65921[782:856] tembl-id:X65921[951:1095] tembl-id:X65921[1557:1612] tembl-id:X65921[1787:1912] | 
You may find the program yank useful for creating List files.
| >X65921 X65921.1 H.sapiens fau 1 gene atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg cccacctttggcaagaagaagggccccaatgccaactcttaa | 
The result is a normal sequence file containing a single sequence resulting from the concatenation of the input sequences.
union is most useful when the input sequences are specified in a "list file". A list file contain references to any number of sequences which are retrieved from some other file or database. Each sequence reference is a Uniform Sequence Address (USA) which can include the specification of sub-regions of the sequence, eg. em:x65923[20:55]). Specifying several such subregions in a sequence or sequences allows you to enter disjoint sequences to be joined.
| Program name | Description | 
|---|---|
| aligncopy | Reads and writes alignments | 
| aligncopypair | Reads and writes pairs from alignments | 
| biosed | Replace or delete sequence sections | 
| codcopy | Copy and reformat a codon usage table | 
| cutseq | Removes a section from a sequence | 
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences | 
| descseq | Alter the name or description of a sequence | 
| entret | Retrieves sequence entries from flatfile databases and files | 
| extractalign | Extract regions from a sequence alignment | 
| extractfeat | Extract features from sequence(s) | 
| extractseq | Extract regions from a sequence | 
| featcopy | Reads and writes a feature table | 
| featreport | Reads and writes a feature table | 
| listor | Write a list file of the logical OR of two sets of sequences | 
| makenucseq | Create random nucleotide sequences | 
| makeprotseq | Create random protein sequences | 
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N | 
| maskambigprot | Masks all ambiguity characters in protein sequences with X | 
| maskfeat | Write a sequence with masked features | 
| maskseq | Write a sequence with masked regions | 
| newseq | Create a sequence file from a typed-in sequence | 
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file | 
| noreturn | Remove carriage return from ASCII files | 
| nospace | Remove all whitespace from an ASCII text file | 
| notab | Replace tabs with spaces in an ASCII text file | 
| notseq | Write to file a subset of an input stream of sequences | 
| nthseq | Write to file a single sequence from an input stream of sequences | 
| pasteseq | Insert one sequence into another | 
| revseq | Reverse and complement a nucleotide sequence | 
| seqret | Reads and writes (returns) sequences | 
| seqretsplit | Reads sequences and writes them to individual files | 
| sizeseq | Sort sequences by size | 
| skipredundant | Remove redundant sequences from an input set | 
| skipseq | Reads and writes (returns) sequences, skipping first few | 
| splitter | Split sequence(s) into smaller sequences | 
| trimest | Remove poly-A tails from nucleotide sequences | 
| trimseq | Remove unwanted characters from start and end of sequence(s) | 
| trimspace | Remove extra whitespace from an ASCII text file | 
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) | 
| yank | Add a sequence reference (a full USA) to a list file | 
You may find the program yank useful for creating List files.