|   | featreport | 
| % featreport Reads and writes a feature table Input sequence: paamir.fasta Input features: paamir.gff Output report [x13776.featreport]: test.out | 
Go to the input files for this example
Go to the output files for this example
| 
   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Sequence filename and optional format, or
                                  reference (input USA)
  [-features]          features   (no help text) features value
  [-outfile]           report     [*.featreport] Output report file name
   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:
   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name
   "-features" associated qualifiers
   -fformat2           string     Features format
   -fopenfile2         string     Features file name
   -fask2              boolean    Prompt for begin/end/reverse
   -fbegin2            integer    Start of the features to be used
   -fend2              integer    End of the features to be used
   -freverse2          boolean    Reverse (if DNA)
   "-outfile" associated qualifiers
   -rformat3           string     Report format
   -rname3             string     Base file name
   -rextension3        string     File name extension
   -rdirectory3        string     Output directory
   -raccshow3          boolean    Show accession number in the report
   -rdesshow3          boolean    Show description in the report
   -rscoreshow3        boolean    Show the score in the report
   -rstrandshow3       boolean    Show the nucleotide strand in the report
   -rusashow3          boolean    Show the full USA in the report
   -rmaxall3           integer    Maximum total hits to report
   -rmaxseq3           integer    Maximum hits to report for one sequence
   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
 | 
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) | Sequence filename and optional format, or reference (input USA) | Readable sequence | Required | 
| [-features] (Parameter 2) | (no help text) features value | Readable feature table | Required | 
| [-outfile] (Parameter 3) | Output report file name | Report output file | <*>.featreport | 
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
| >X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgat ctacctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcac aggagaggaaacggatgggatcgcaccaggagcggccgctgatcggcctgctgttctccg aaaccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcg agcaactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccgggggg tacggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcg agcgcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccga acatcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctga ttcgccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatct acattccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccagg cgcgcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcg ccatcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcg aggcggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgcctt acttctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttct tcccggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgc tcggccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgt acgacatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccaca gccgcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggc agtcgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggt ccgccagcatgggcgggggaccgctcccatgagcgccaactcgctgctcggcagcctgcg cgagttgcaggtgctggtcctcaacccgccgggggaggtcagcgacgccctggtcttgca gctgatccgcatcggttgttcggtgcgccagtgctggccgccgccggaagccttcgacgt gccggtggacgtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgc gctgctcgccgccgggactccgcgcactaccctggtggcgctggtggagtacgaaagccc cgcggtgctctcgcagatcatcgagctggagtgccacggcgtgatcacccagccgctcga tgcccaccgggtgctgcctgtgctggtatcggcgcggcgcatcagcgaggaaatggcgaa gctgaagcagaagaccgagcagctccaggaccgcatcgccggccaggcccggatcaacca ggccaaggtgttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacct gtcgcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcaggagttgctggg aaacgagccgtccgcctgagcgatccgggccgaccagaacaataacaagaggggtatcgt catcatgctgggactggttctgctgtacgttggcgcggtgctgtttctcaatgccgtctg gttgctgggcaagatcagcggtcgggaggtggcggtgatcaacttcctggtcggcgtgct gagcgcctgcgtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccgccaaccagtt cctcgag | 
| ##gff-version 2.0 ##date 2003-02-14 ##Type DNA PAAMIR PAAMIR EMBL source 1 2167 0.000 + . Sequence "PAAMIR.1" ; db_xref "taxon:287" ; organism "Pseudomonas aeruginosa" ; strain "PAC" ; isolate "PAC 1" ; map "38 min" PAAMIR EMBL CDS 1289 1879 0.000 + . Sequence "PAAMIR.2" ; db_xref "SWISS-PROT:P10932" ; note "aliphatic amidase regulator, positive regulator of amiE" ; transl_table 11 ; gene "amiR" ; protein_id "CAA32023.1" ; translation "MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA" PAAMIR EMBL CDS 135 1292 0.000 + . Sequence "PAAMIR.3" ; db_xref "SWISS-PROT:P27017" ; note "negative regulator of amiR" ; transl_table 11 ; gene "amiC" ; protein_id "CAA32024.1" ; translation "MGSHQERPLIGLLFSETGVTADIERSHAYGALLAVEQLNREGGVGGRPIETLSQDPGGDPDRYRLCAEDFIRNRGVRFLVGCYMSHTRKAVMPVVERADALLCYPTPYEGFEYSPNIVYGGPAPNQNSAPLAAYLIRHYGERVVFIGSDYIYPRESNHVMRHLYRQHGGTVLEEIYIPLYPSDDDLQRAVERIYQARADVVFSTVVGTGTAELYRAIARRYGDGRRPPIASLTTSEAEVAKMESDVAEGQVVVAPYFSSIDTPASRAFVQACHGFFPENATITAWAEAAYWQTLLLGRAAQAAGNWRVEDVQRHLYDIDIDAPQGPVRVERQNNHSRLSSRIAEIDARGVFQVRWQSPEPIRPDPYVVVHNLDDWSASMGGGPLP" PAAMIR EMBL promoter 8 24 0.000 + . Sequence "PAAMIR.4" ; note "proposed rpoN-dependent promoter" PAAMIR EMBL promoter 65 81 0.000 + . Sequence "PAAMIR.5" ; note "proposed rpoN-dependent promoter" PAAMIR EMBL RBS 121 126 0.000 + . Sequence "PAAMIR.6" ; note "proposed Shine-Dalgarno sequence" PAAMIR EMBL variation 912 1167 0.000 + . Sequence "PAAMIR.7" ; note "ClaI fragment deleted in pSW36, constitutive phenotype" ; replace "" ; gene "amiC" PAAMIR EMBL misc_feature 1 1 0.000 + . Sequence "PAAMIR.8" ; FeatFlags "0x40" ; note "last base of an XhoI site" PAAMIR EMBL misc_feature 648 653 0.000 + . Sequence "PAAMIR.9" ; note "end of 658bp XhoI fragment, deletion in pSW3 causes constitutive expression of amiE" PAAMIR EMBL conflict 1281 1281 0.000 + . Sequence "PAAMIR.10" ; FeatFlags "0x40" ; replace "g" ; citation [3] | 
| ##gff-version 3 ##sequence-region PAAMIR 1 2167 #!Date 2008-07-15 #!Type DNA #!Source-version EMBOSS 6.0.0 PAAMIR EMBL databank_entry 1 2167 0.000 + . ID="PAAMIR.1";db_xref="taxon:287";organism="Pseudomonas aeruginosa";strain="PAC";isolate="PAC 1";map="38 min" PAAMIR EMBL CDS 1289 1879 0.000 + 0 ID="PAAMIR.2";db_xref="SWISS-PROT:P10932";note="aliphatic amidase regulator, positive regulator of amiE";transl_table=11;gene="amiR";protein_id="CAA32023.1";translation="MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA" PAAMIR EMBL CDS 135 1292 0.000 + 0 ID="PAAMIR.3";db_xref="SWISS-PROT:P27017";note="negative regulator of amiR";transl_table=11;gene="amiC";protein_id="CAA32024.1";translation="MGSHQERPLIGLLFSETGVTADIERSHAYGALLAVEQLNREGGVGGRPIETLSQDPGGDPDRYRLCAEDFIRNRGVRFLVGCYMSHTRKAVMPVVERADALLCYPTPYEGFEYSPNIVYGGPAPNQNSAPLAAYLIRHYGERVVFIGSDYIYPRESNHVMRHLYRQHGGTVLEEIYIPLYPSDDDLQRAVERIYQARADVVFSTVVGTGTAELYRAIARRYGDGRRPPIASLTTSEAEVAKMESDVAEGQVVVAPYFSSIDTPASRAFVQACHGFFPENATITAWAEAAYWQTLLLGRAAQAAGNWRVEDVQRHLYDIDIDAPQGPVRVERQNNHSRLSSRIAEIDARGVFQVRWQSPEPIRPDPYVVVHNLDDWSASMGGGPLP" PAAMIR EMBL promoter 8 24 0.000 + . ID="PAAMIR.4";note="proposed rpoN-dependent promoter" PAAMIR EMBL promoter 65 81 0.000 + . ID="PAAMIR.5";note="proposed rpoN-dependent promoter" PAAMIR EMBL ribosome_entry_site 121 126 0.000 + . ID="PAAMIR.6";note="proposed Shine-Dalgarno sequence" PAAMIR EMBL sequence_variant 912 1167 0.000 + . ID="PAAMIR.7";note="ClaI fragment deleted in pSW36, constitutive phenotype";replace="";gene="amiC" PAAMIR EMBL located_sequence_feature 1 1 0.000 + . ID="PAAMIR.8";featflags="0x40";note="last base of an XhoI site" PAAMIR EMBL located_sequence_feature 648 653 0.000 + . ID="PAAMIR.9";note="end of 658bp XhoI fragment, deletion in pSW3 causes constitutive expression of amiE" PAAMIR EMBL sequence_conflict 1281 1281 0.000 + . ID="PAAMIR.10";featflags="0x40";replace="g";citation=[3] | 
| Program name | Description | 
|---|---|
| aligncopy | Reads and writes alignments | 
| aligncopypair | Reads and writes pairs from alignments | 
| biosed | Replace or delete sequence sections | 
| codcopy | Copy and reformat a codon usage table | 
| cutseq | Removes a section from a sequence | 
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences | 
| descseq | Alter the name or description of a sequence | 
| entret | Retrieves sequence entries from flatfile databases and files | 
| extractalign | Extract regions from a sequence alignment | 
| extractfeat | Extract features from sequence(s) | 
| extractseq | Extract regions from a sequence | 
| featcopy | Reads and writes a feature table | 
| listor | Write a list file of the logical OR of two sets of sequences | 
| makenucseq | Create random nucleotide sequences | 
| makeprotseq | Create random protein sequences | 
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N | 
| maskambigprot | Masks all ambiguity characters in protein sequences with X | 
| maskfeat | Write a sequence with masked features | 
| maskseq | Write a sequence with masked regions | 
| newseq | Create a sequence file from a typed-in sequence | 
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file | 
| noreturn | Remove carriage return from ASCII files | 
| nospace | Remove all whitespace from an ASCII text file | 
| notab | Replace tabs with spaces in an ASCII text file | 
| notseq | Write to file a subset of an input stream of sequences | 
| nthseq | Write to file a single sequence from an input stream of sequences | 
| pasteseq | Insert one sequence into another | 
| revseq | Reverse and complement a nucleotide sequence | 
| seqret | Reads and writes (returns) sequences | 
| seqretsplit | Reads sequences and writes them to individual files | 
| sizeseq | Sort sequences by size | 
| skipredundant | Remove redundant sequences from an input set | 
| skipseq | Reads and writes (returns) sequences, skipping first few | 
| splitter | Split sequence(s) into smaller sequences | 
| trimest | Remove poly-A tails from nucleotide sequences | 
| trimseq | Remove unwanted characters from start and end of sequence(s) | 
| trimspace | Remove extra whitespace from an ASCII text file | 
| union | Concatenate multiple sequences into a single sequence | 
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) | 
| yank | Add a sequence reference (a full USA) to a list file |